Copyright©2018 CSIR-Institute of Genomics and Integrative Biology | VS Lab |
hsa_circ_0011946 | |||
Gene | SCMH1 | Organism | Human |
Genome Locus | chr1:41578954-41618413:- | Build | hg19 |
Disease | Breast Cancer | ICD-10 | Malignant neoplasm of breast (C50) |
DBLink | Link to database | PMID | 29593432 |
Experimental Method | |||
Sample Type | Tissues and U251, U118, LN229, and U87MG Cell lines | Comparison | Three pairs of breast cancer and corresponding adjacent non-cancerous tissues and Six breast cancer cell lines (HS-578T, T47D, MCF-7, BT549, MDA-MB-231, and SKBR-3) |
Method for Estimation | Quantitative PCR | PCR Details | |
Primers (Experimented) | Forward GCTGGTGTTCCTTGACTGGA ReverseCACTGTAGCAAACCAGCATTTCT | Statistics | Fold Change : Upregulated pvalue : p<0.05 |
Citation | |||
Zhou, J, Zhang, WW, Peng, F, Sun, JY, He, ZY, Wu, SG (2018). Downregulation of hsa_circ_0011946 suppresses the migration and invasion of the breast cancer cell line MCF-7 by targeting RFC3. Cancer Manag Res, 10:535-544. |